Salivary Protein Card


Accession: Sp001589    Nitrophorin-7   [Rhodnius prolixus]

Basic info
Organism Rhodnius prolixus
Taxonomy Insecta > Hemiptera > Reduviidae > Rhodnius > Rhodnius prolixus
Protein Description Nitrophorin-7
Mass Weight 22900.991
Isoelectric Point 8.838
Annotation
Function Converts nitrite as the sole substrate to form nitric oxide gas (NO). NO(2-) serves both as an electron donor and as an electron acceptor. Binds to negatively charged cell surfaces of activated platelets; binds to L-a-phosphatidyl-L-serine (PS)-bearing phospholipid membranes. Once bound on an activated platelet, NP7 releases its stored nitric oxide gas (NO) into the victims tissues while feeding, resulting in vasodilation and inhibition of platelet aggregation. Also acts as an anticoagulant by blocking coagulation-factor binding sites. Has antihistamine activity; binds histamine with high affinity.
Pfam
PF02087 Nitrophorin
Features
Feature key Position Length
Signal Peptide 1-20 20
Chain 21-205 185
Cross-Reference
NCBI Nucleotide AY585746.1
NCBI Protein AAS94228.1
UniProt Q6PQK2
Sequence
ATGGAACTGTACACAGCGTTGTTGGCCGTAACCATTCTGAGTCCATCGTCAATAGTGGGACTACCTGGAGAGTGTAGTGTAAATGTAATTCCTAAAAAAAATTTAGATAAAGCCAAGTTTTTCAGCGGTACTTGGTATGAGACTCATTATCTAGACATGGATCCTCAGGCTACAGAAAAATTCTGTTTTAGCTTTGCACCAAGAGAATCTGGTGGTACAGTAAAAGAGGCATTATATCACTTCAATGTAGATTCAAAAGTATCATTTTACAATACAGGTACAGGTCCTTTGGAATCGAATGGTGCAAAATACACTGCAAAATTTAATACTGTTGATAAGAAAGGAAAAGAAATAAAACCGGCGGATGAAAAGTACTCTTATACAGTTACCGTTATAGAAGCTGCCAAACAATCTGCTCTGATCCACATATGTTTGCAGGAAGACGGAAAAGATATTGGAGATCTCTATTCTGTTTTAAATCGCAATAAAAATGCGCTACCTAATAAGAAGATTAAAAAAGCTTTGAATAAGGTTAGTTTAGTCTTGACTAAGTTCGTTGTTACCAAAGATCTTGACTGCAAGTACGATGATAAATTTCTTTCTTCGTGGCAAAAATAA
MELYTALLAVTILSPSSIVGLPGECSVNVIPKKNLDKAKFFSGTWYETHYLDMDPQATEKFCFSFAPRESGGTVKEALYHFNVDSKVSFYNTGTGPLESNGAKYTAKFNTVDKKGKEIKPADEKYSYTVTVIEAAKQSALIHICLQEDGKDIGDLYSVLNRNKNALPNKKIKKALNKVSLVLTKFVVTKDLDCKYDDKFLSSWQK

3D Structure
Not available now!
Publication
1. Andersen JF, Gudderra NP, Francischetti IM, Valenzuela JG, Ribeiro JM.;
Recognition of anionic phospholipid membranes by an antihemostatic protein from a blood-feeding insect.;
Biochemistry. 2004 Jun 8;43(22):6987-94.